zgc:113071

Ensembl ID:
ENSDARG00000058943
ZFIN ID:
ZDB-GENE-050327-55
Description:
CUB domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001014355]
Human Orthologue:
CDCP1
Human Description:
CUB domain containing protein 1 [Source:HGNC Symbol;Acc:24357]
Mouse Orthologue:
Cdcp1
Mouse Description:
CUB domain containing protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442010]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18583 Nonsense Available for shipment Available now
sa11377 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081915 Nonsense 80 793 2 9
Genomic Location (Zv9):
Chromosome 16 (position 3471107)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2629483
GRCz11 16 2867149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAGGCTTAYGTGGTYCTCAGAAGTGATACGCTTTTGGATTTCAGCTG[T/A]TCGCAGCCAGAGAAAGTGTTTATTGTGCAGATCATCAGAGACACSGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081915 Nonsense 510 793 6 9
Genomic Location (Zv9):
Chromosome 16 (position 3458349)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2616725
GRCz11 16 2854391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACAAGTTTCAGCGACCGGAGTGTGGCAGCAAAACCAATCTTAAGCTA[T/A]TCGTTCACMCAAGGCATATCGGGTAAGYGCTTTCAGTGTTCAWTATTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link