cldn10

Ensembl ID:
ENSDARG00000058937
ZFIN ID:
ZDB-GENE-030616-510
Description:
claudin 10 [Source:RefSeq peptide;Acc:NP_001007038]
Human Orthologue:
CLDN10
Human Description:
claudin 10 [Source:HGNC Symbol;Acc:2033]
Mouse Orthologue:
Cldn10
Mouse Description:
claudin 10 Gene [Source:MGI Symbol;Acc:MGI:1913101]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45243 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081900 Nonsense 154 236 3 5
Genomic Location (Zv9):
Chromosome 6 (position 7217692)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7143708
GRCz11 6 7300877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGCACACCGGATCACATCAGAGTTTTTTGACCCCTTATTTGTGAAA[C/T]AGAAGTAAGAAATATCAGTCAAATATCACATCTCCTTGAACTTTCTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link