si:ch73-142c19.1

Ensembl ID:
ENSDARG00000058871
ZFIN ID:
ZDB-GENE-090311-15
Description:
hypothetical protein LOC100142653 [Source:RefSeq peptide;Acc:NP_001116100]
Human Orthologue:
FBXW12
Human Description:
F-box and WD repeat domain containing 12 [Source:HGNC Symbol;Acc:20729]
Mouse Orthologues:
Fbxw13, Fbxw14, Fbxw15, Fbxw16, Fbxw17, Fbxw18, Fbxw19, Fbxw20, Fbxw21, Fbxw22, Fbxw24, Fbxw26, Fbxw28
Mouse Descriptions:
F-box and WD-40 domain protein 13 Gene [Source:MGI Symbol;Acc:MGI:3505590]
F-box and WD-40 domain protein 14 Gene [Source:MGI Symbol;Acc:MGI:1354703]
F-box and WD-40 domain protein 15 Gene [Source:MGI Symbol;Acc:MGI:3505701]
F-box and WD-40 domain protein 16 Gene [Source:MGI Symbol;Acc:MGI:2443324]
F-box and WD-40 domain protein 17 Gene [Source:MGI Symbol;Acc:MGI:1923584]
F-box and WD-40 domain protein 18 Gene [Source:MGI Symbol;Acc:MGI:3505704]
F-box and WD-40 domain protein 19 Gene [Source:MGI Symbol;Acc:MGI:3505706]
F-box and WD-40 domain protein 20 Gene [Source:MGI Symbol;Acc:MGI:3584372]
F-box and WD-40 domain protein 21 Gene [Source:MGI Symbol;Acc:MGI:2443323]
F-box and WD-40 domain protein 22 Gene [Source:MGI Symbol;Acc:MGI:3643290]
F-box and WD-40 domain protein 24 Gene [Source:MGI Symbol;Acc:MGI:3646659]
F-box and WD-40 domain protein 26 Gene [Source:MGI Symbol;Acc:MGI:3646662]
F-box and WD-40 domain protein 28 Gene [Source:MGI Symbol;Acc:MGI:3779847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45785 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081823 Essential Splice Site 396 471 9 10
ENSDART00000146941 Essential Splice Site 350 425 8 9
Genomic Location (Zv9):
Chromosome 23 (position 4445247)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4455271
GRCz11 23 4394172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAACCACAACATTTTCACATCAGTGTATAAAAGTGTTGTTTTTTGC[A/T]GGACAGTTTTAGGGTGGTGACAGCGTCTCGAGACCTGTCTCTCAGAGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link