zbtb24

Ensembl ID:
ENSDARG00000058863
ZFIN ID:
ZDB-GENE-081022-123
Description:
Zinc finger and BTB domain-containing protein 24 [Source:UniProtKB/Swiss-Prot;Acc:Q52KB5]
Human Orthologue:
ZBTB24
Human Description:
zinc finger and BTB domain containing 24 [Source:HGNC Symbol;Acc:21143]
Mouse Orthologue:
Zbtb24
Mouse Description:
zinc finger and BTB domain containing 24 Gene [Source:MGI Symbol;Acc:MGI:3039618]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39144 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081813 Nonsense 487 672 6 6
Genomic Location (Zv9):
Chromosome 17 (position 6881185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCACAATCAGCACCAGAACAACAAGAACAAGAACAACAGCAGCAGCAG[C/T]AAACATCAGGAGATAAAGAACTGCACAGCATCCTCCAGCTCCAACCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link