zgc:162740

Ensembl ID:
ENSDARG00000058842
ZFIN IDs:
ZDB-GENE-030131-6219, ZDB-GENE-030131-6219
Description:
zinc finger protein 609 [Source:RefSeq peptide;Acc:NP_001091863]
Human Orthologue:
ZNF609
Human Description:
zinc finger protein 609 [Source:HGNC Symbol;Acc:29003]
Mouse Orthologue:
Zfp609
Mouse Description:
zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24582 Nonsense Available for shipment Available now
sa24583 Nonsense Available for shipment Available now
sa11722 Nonsense Available for shipment Available now
sa24584 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081790 Nonsense 753 1399 5 8
ENSDART00000124970 Nonsense 753 1399 4 8
Genomic Location (Zv9):
Chromosome 25 (position 825341)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 744145
GRCz11 25 826276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGGGAAACCTGAGGAAGGTAAAAGCCCATATTCTGAGAGTTCAGAC[C/T]AAGGCGGGAGGAATGAAGGGATGTTAAATGGATCCTCAGATCCACATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081790 Nonsense 1007 1399 5 8
ENSDART00000124970 Nonsense 1007 1399 4 8
Genomic Location (Zv9):
Chromosome 25 (position 826103)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 743383
GRCz11 25 825514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACCACCTGATGAACCCAGCGTACAGACAGCAGTGTGAGGACAGACAA[C/T]GACAAGTAGCCGAGCAACATCGAGCCTCTGAGAAAAAATCTGAAGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081790 Nonsense 1132 1399 6 8
ENSDART00000124970 Nonsense 1132 1399 5 8
Genomic Location (Zv9):
Chromosome 25 (position 826616)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 742870
GRCz11 25 825001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCATTATGTGCATTAAAATCTCCTTCTCTTCCAGGAGCCRGATTCT[C/T]GATTGTGGCCCTATGTTTACCCCAGCAAGTACCCTGATCCTCAAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081790   None 1399 8 8
ENSDART00000124970 Essential Splice Site None 1399 None 8
Genomic Location (Zv9):
Chromosome 25 (position 829894)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 739592
GRCz11 25 821723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGCCTCTGCCCCTTCACTTTACCCTCCCGCACGGAGGTGAGAATGG[T/A]AAGATGTATCAAAATTACCTTCAGTCTCTTCATATATTTTAGGTTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link