zgc:153290

Ensembl ID:
ENSDARG00000058828
ZFIN ID:
ZDB-GENE-060825-200
Description:
coiled-coil domain-containing protein 51 [Source:RefSeq peptide;Acc:NP_001038927]
Human Orthologue:
CCDC51
Human Description:
coiled-coil domain containing 51 [Source:HGNC Symbol;Acc:25714]
Mouse Orthologue:
Ccdc51
Mouse Description:
coiled-coil domain containing 51 Gene [Source:MGI Symbol;Acc:MGI:1913908]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1722 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081774 Essential Splice Site 162 421 3 4
Genomic Location (Zv9):
Chromosome 22 (position 5584667)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5631016
GRCz11 22 5660862
KASP Assay ID:
554-1668.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGCACATTATTTAGAGTTAGCAACACTTGAACACAAGCTACTGCAG[G/A]TGGGTTATTACGGAAAGACATTTCATCRGTCGTATTTTCATTCTGTCTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link