zgc:113102

Ensembl ID:
ENSDARG00000058827
ZFIN ID:
ZDB-GENE-050306-35
Description:
Zgc:113102 [Source:UniProtKB/TrEMBL;Acc:Q5CZM2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39989 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106343 Nonsense 115 281 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7857591)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7378226
GRCz11 3 7264066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATACAGAGGGGAAGCCTTATTCATGCACTGTGTGTGGAAAGACTTTC[A/T]GACATGAAGACGGTTTTAAAAATCATCAGAAGATCCACACCGGTATGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link