zgc:171887

Ensembl ID:
ENSDARG00000058791
ZFIN ID:
ZDB-GENE-080220-39
Description:
SLAM family member [Source:RefSeq peptide;Acc:NP_001107117]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25175 Nonsense Mutation detected in F1 DNA During 2018
sa1791 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081734 Nonsense 41 240 2 4
ENSDART00000106102 Nonsense 39 75 2 2
ENSDART00000139276 Nonsense 86 285 3 5
Genomic Location (Zv9):
Chromosome 22 (position 6022374)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6068441
GRCz11 22 6098287
KASP Assay ID:
554-7468.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGTCAATGAAAACACTTCAATAGCTGTAGTTGATATAATGGACACC[A/T]GAGTCACTGTATATGATTCCACTGAGAGATTCAGAAACAGACTGAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081734 Nonsense 186 240 3 4
ENSDART00000106102   None 75 None 2
ENSDART00000139276 Nonsense 231 285 4 5
Genomic Location (Zv9):
Chromosome 22 (position 6022909)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6068976
GRCz11 22 6098822
KASP Assay ID:
554-1783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAACACCATCAGCAACCAGACCACACATCTGGACATCAGCACACTCTG[T/A]CTGACATCATGTTCAGGTACATAATCATTGATATTAGAGCTTATTATTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link