slc9a2

Ensembl ID:
ENSDARG00000058780
ZFIN ID:
ZDB-GENE-070912-541
Description:
sodium/hydrogen exchanger 2 [Source:RefSeq peptide;Acc:NP_001107567]
Human Orthologues:
SLC9A2, SLC9A4
Human Descriptions:
solute carrier family 9 (sodium/hydrogen exchanger), member 2 [Source:HGNC Symbol;Acc:11072]
solute carrier family 9 (sodium/hydrogen exchanger), member 4 [Source:HGNC Symbol;Acc:11077]
Mouse Orthologues:
Slc9a2, Slc9a4
Mouse Descriptions:
solute carrier family 9 (sodium/hydrogen exchanger), member 2 Gene [Source:MGI Symbol;Acc:MGI:105075
solute carrier family 9 (sodium/hydrogen exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:105074

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34552 Nonsense Mutation detected in F1 DNA During 2018
sa21430 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081718 Nonsense 259 795 3 12
Genomic Location (Zv9):
Chromosome 9 (position 7025905)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7005998
GRCz11 9 6984389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTCCATTTCAGGTACTGTATAATCTCTTCAATCATGTAGCAGCGATG[G/T]AAGTGGATGAACCTGCAGTCATTTTCATGGACATTGGCGGATTTTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081718 Nonsense 732 795 12 12
Genomic Location (Zv9):
Chromosome 9 (position 7004908)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6985001
GRCz11 9 6963392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTGAACGATCTGAGGGAAGATAATGAACCAAATGAAGAAATTCCTTA[C/A]AAGATGTCACATCCAAGGTCAAAATTCAGACATTCAGGACATCAAACCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link