zgc:175176

Ensembl ID:
ENSDARG00000058775
ZFIN ID:
ZDB-GENE-080204-92
Description:
hypothetical protein LOC797890 [Source:RefSeq peptide;Acc:NP_001107932]
Human Orthologue:
SLC22A3
Human Description:
solute carrier family 22 (extraneuronal monoamine transporter), member 3 [Source:HGNC Symbol;Acc:109
Mouse Orthologue:
Slc22a3
Mouse Description:
solute carrier family 22 (organic cation transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:1333

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081707 Nonsense 477 554 9 11
Genomic Location (Zv9):
Chromosome 17 (position 6096233)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6175169
GRCz11 17 6332399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCTTCAGCCAGTGATATCGGAGCAGTCGTTGCTCCGTTTATTCTGTA[C/A]AGATTAGCTAGTATTTGGCAAGAACTTCCCCTCTTGGTCTATGGTGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Common variant in 6q26-q27 is associated with distal colon cancer in an Asian population. (View Study)
  • Coronary heart disease: Genome-wide haplotype association study identifies the SLC22A3-LPAL2-LPA gene cluster as a risk locus for coronary artery disease. (View Study)
  • Lp (a) levels: Genetic variants, plasma lipoprotein(a) levels, and risk of cardiovascular morbidity and mortality among two prospective cohorts of type 2 diabetes. (View Study)
  • Prostate cancer: Multiple newly identified loci associated with prostate cancer susceptibility. (View Study)
  • Response to hepatitis C treatment: Serum ferritin levels are associated with a distinct phenotype of chronic hepatitis C poorly responding to pegylated interferon-alpha and ribavirin therapy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link