ubap1

Ensembl ID:
ENSDARG00000058746
ZFIN ID:
ZDB-GENE-040426-950
Description:
ubiquitin-associated protein 1 [Source:RefSeq peptide;Acc:NP_956508]
Human Orthologue:
UBAP1
Human Description:
ubiquitin associated protein 1 [Source:HGNC Symbol;Acc:12461]
Mouse Orthologues:
Gm514, Ubap1
Mouse Descriptions:
predicted gene 514 Gene [Source:MGI Symbol;Acc:MGI:2685360]
ubiquitin-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:2149543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37251 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081676 Nonsense 43 296 3 8
Genomic Location (Zv9):
Chromosome 21 (position 10291956)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11775319
GRCz11 21 11867947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGAAATTTCGTTGTCCCTCAAAAGTGGGCCTTCCTATTGGTTTCTG[T/A]TTGTCTGACTGTAATGCCATACTCTCAGATTTGCAAGTAAGTCTGATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link