zgc:100843

Ensembl ID:
ENSDARG00000058732
ZFIN ID:
ZDB-GENE-041010-82
Description:
Secretagogin [Source:UniProtKB/Swiss-Prot;Acc:Q5XJX1]
Human Orthologue:
SCGN
Human Description:
secretagogin, EF-hand calcium binding protein [Source:HGNC Symbol;Acc:16941]
Mouse Orthologue:
Scgn
Mouse Description:
secretagogin, EF-hand calcium binding protein Gene [Source:MGI Symbol;Acc:MGI:2384873]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25001 Nonsense Mutation detected in F1 DNA During 2018
sa36035 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081649 Nonsense 45 272 2 11
Genomic Location (Zv9):
Chromosome 16 (position 7590926)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6436658
GRCz11 16 6377336
KASP Assay ID:
554-7395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGGGAAAGAGCTGGATGACTTTTTCCGTCACATGCTGAAGAAACTA[C/T]AGCCAAAGGTATCAAACATAAACCACACAGGTTAATAAGAAATATAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081649 Essential Splice Site 230 272 10 11
Genomic Location (Zv9):
Chromosome 16 (position 7572581)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6418313
GRCz11 16 6358991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGACCAGAGGTGGACGGCTTTGTCAAAGACATGATGGAACTAGTAAGG[G/A]TAAGTGCGTTGTACAAAACTCCCTATAGAGAGGCAAAATCAATCACATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
  • Uric acid levels: Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link