
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000058685
- Ensembl ID:
- ENSDARG00000058685
- Mouse Orthologues:
- Gm4070, Gvin1
- Mouse Descriptions:
- GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
- predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12967 | Nonsense | Available for shipment | Available now |
sa29158 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12967
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053387 | Nonsense | 161 | 803 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 19 (position 8321257)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7779796 GRCz11 19 7698721 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTTTCGTCAGACTWGGAAAAAATCCAAATATTTCCAAATCTGAGCTTT[T/G]AAACAAGCTCCTTTCAACCAGTCAGCAAAAMCATGATGCTTTTGTTCACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29158
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053387 | Nonsense | 408 | 803 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 19 (position 8320517)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7779056 GRCz11 19 7697981 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAATGCAAGAAAACAGAACATTGAGCACTACAAGAGTGAACTCAAAAGT[C/T]AAATACAGAATCTTAGAATGGAACAAGGAAGCCACAGGATGAGTGACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: