aqp10b

Ensembl ID:
ENSDARG00000058678
ZFIN ID:
ZDB-GENE-060503-57
Description:
aquaporin 10b [Source:RefSeq peptide;Acc:NP_001076516]
Human Orthologue:
AQP10
Human Description:
aquaporin 10 [Source:HGNC Symbol;Acc:16029]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39229 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081592 Nonsense 255 309 6 6
ENSDART00000140719 Nonsense 222 276 6 6
Genomic Location (Zv9):
Chromosome 19 (position 8438658)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7897197
GRCz11 19 7816122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTATAATCGTAACGTGTGTCGGGGCTCTTCTGGGATCATTACTGTAC[G/T]AGCTGCTGATTGGAGTTCATCATCCTGACTCAGAGGCAGTGGATCATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link