zgc:153268

Ensembl ID:
ENSDARG00000058644
ZFIN ID:
ZDB-GENE-061013-537
Description:
dnaJ homolog subfamily B member 2 [Source:RefSeq peptide;Acc:NP_001073462]
Human Orthologues:
DNAJB6, DNAJB7, DNAJB8
Human Descriptions:
DnaJ (Hsp40) homolog, subfamily B, member 6 [Source:HGNC Symbol;Acc:14888]
DnaJ (Hsp40) homolog, subfamily B, member 7 [Source:HGNC Symbol;Acc:24986]
DnaJ (Hsp40) homolog, subfamily B, member 8 [Source:HGNC Symbol;Acc:23699]
Mouse Orthologues:
Dnajb3, Dnajb6, Dnajb7, Dnajb8
Mouse Descriptions:
DnaJ (Hsp40) homolog, subfamily B, member 3 Gene [Source:MGI Symbol;Acc:MGI:1306822]
DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI Symbol;Acc:MGI:1344381]
DnaJ (Hsp40) homolog, subfamily B, member 7 Gene [Source:MGI Symbol;Acc:MGI:1914012]
DnaJ (Hsp40) homolog, subfamily B, member 8 Gene [Source:MGI Symbol;Acc:MGI:1922801]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17753 Essential Splice Site Available for shipment Available now
sa41355 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102706 Essential Splice Site 59 389 None 9
ENSDART00000135616   None 120 None 4
ENSDART00000137957 Essential Splice Site 59 193 None 8

The following transcripts of ENSDARG00000058644 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 7688343)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7668436
GRCz11 9 7646827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAAAAATTCAAGGAGATAGCAGAGGCCTACGAAGTTCTTTCAGACAG[T/A]AAGAAGATGAGACTTTTACCTCTACAGCAAGTTCATTAACTAAGTAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102706 Essential Splice Site 117 389 6 9
ENSDART00000135616   None 120 None 4
ENSDART00000137957 Essential Splice Site 117 193 6 8

The following transcripts of ENSDARG00000058644 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 7683565)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7663658
GRCz11 9 7642049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCTCCCTTACCATGCTCTCTTTAACCCTCTGCATACTTTTCGTCTA[G/T]ATGATTTCCCATTTGGTGGAATGCACAGTGGTTTTCACAGTTCCTCCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link