zgc:162472

Ensembl ID:
ENSDARG00000058630
ZFIN IDs:
ZDB-GENE-050809-88, ZDB-GENE-050809-88
Description:
hypothetical protein LOC553495 [Source:RefSeq peptide;Acc:NP_001077289]
Human Orthologue:
BDP1
Human Description:
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB [Source:HGNC Sy
Mouse Orthologue:
Bdp1
Mouse Description:
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB Gene [Source:MG

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44959 Nonsense Mutation detected in F1 DNA During 2018
sa23864 Essential Splice Site Available for shipment Available now
sa23863 Nonsense Available for shipment Available now
sa17899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124635 Nonsense 603 1627 10 27
ENSDART00000125487   None 562 None 11
Genomic Location (Zv9):
Chromosome 21 (position 9778004)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11261367
GRCz11 21 11353995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTTCAAATGATGGAGAAAGTGATGTCACTCCAAAGAGACGCAGGGGA[C/T]GAGCAGCGAAAAATACAGACAGGGACATTAAGAGGATATATGAAGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124635 Essential Splice Site 908 1627 16 27
ENSDART00000125487   None 562 None 11
Genomic Location (Zv9):
Chromosome 21 (position 9768966)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11252329
GRCz11 21 11344957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCTAGTTGTATTGGATGGGATGGTACTAATTTGTGTCTCGTTTTGTA[G/T]GATGTCATTGAGTTTCTTGACCCAGAACACATGGAAGGTGAGGAGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124635 Nonsense 1561 1627 26 27
ENSDART00000125487   None 562 None 11
Genomic Location (Zv9):
Chromosome 21 (position 9754899)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11238262
GRCz11 21 11330890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATCCTTCATTTCAACAAAAAGTACACAAGGAGCACCAACACGTCAT[C/T]GAGGATCCAAACCAGGAGTCAACACTGCCCGTCCTGACAGAAAACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124635 Nonsense 1564 1627 26 27
ENSDART00000125487   None 562 None 11
Genomic Location (Zv9):
Chromosome 21 (position 9754890)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11238253
GRCz11 21 11330881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTTCAACAAAAAGTACACAAGGAGCMCCAACACGTCATCGAGGATCC[A/T]AACCAGSAGTCAACACTGCCCRTCCTGACAGAAMACAGGTAGCGAGTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link