zgc:113385

Ensembl ID:
ENSDARG00000058622
ZFIN ID:
ZDB-GENE-030131-3502
Description:
muted [Source:RefSeq peptide;Acc:NP_001025237]
Human Orthologue:
MUTED
Human Description:
muted homolog (mouse) [Source:HGNC Symbol;Acc:18561]
Mouse Orthologue:
Muted
Mouse Description:
muted Gene [Source:MGI Symbol;Acc:MGI:2178598]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31098 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081515 Nonsense 102 154 5 5
Genomic Location (Zv9):
Chromosome 24 (position 8106326)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7963257
GRCz11 24 7992576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAATAATATGTGTTTGGCACATTGTGTGTGTCCAGAGCACACATCTG[C/T]AGGTGTGTGCAGAGATGCGGAAGCGGGACTGGGAAGAGTTCCAGAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link