
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-235f6.2
- Ensembl ID:
- ENSDARG00000058598
- ZFIN ID:
- ZDB-GENE-090313-99
- Human Orthologue:
- SOX18
- Human Description:
- SRY (sex determining region Y)-box 18 [Source:HGNC Symbol;Acc:11194]
- Mouse Orthologue:
- Sox18
- Mouse Description:
- SRY-box containing gene 18 Gene [Source:MGI Symbol;Acc:MGI:103559]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12315 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12315
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064496 | Nonsense | 132 | 431 | 2 | 2 |
ENSDART00000132992 | Nonsense | 132 | 184 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 23 (position 8905868)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 8864009 GRCz11 23 8798979 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTAGCCCAAATACAATGACACTGATTGGATGCTGTTTTTAGGTCAGTCCT[G/A]GAAGGCGCTGAGCACACTCGACAAGCGTCCGTTTGTGGAGGARGCCGAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: