si:dkey-30c15.5

Ensembl ID:
ENSDARG00000058587
ZFIN ID:
ZDB-GENE-060503-732
Description:
Coiled-coil domain-containing protein 79 [Source:UniProtKB/Swiss-Prot;Acc:Q1LX29]
Human Orthologue:
AC044802.2
Human Description:
coiled-coil domain-containing protein 79 [Source:RefSeq peptide;Acc:NP_001129977]
Mouse Orthologue:
Ccdc79
Mouse Description:
coiled-coil domain containing 79 Gene [Source:MGI Symbol;Acc:MGI:2443187]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15008 Essential Splice Site Available for shipment Available now
sa615 Nonsense Available for shipment Available now
sa23225 Nonsense Available for shipment Available now
sa6499 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081468 Essential Splice Site 83 814 2 19
ENSDART00000142270 Essential Splice Site 83 814 4 21
Genomic Location (Zv9):
Chromosome 18 (position 6922460)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7500150
GRCz11 18 7459085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAAGAGACTGCACTATTTACACTTGCATCTTTGGCTGAACTGCATGG[T/A]ATGTGTTTGGTTACATATGGAAACAGTTAAGWGAGCACTTTCAAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081468 Nonsense 208 814 6 19
ENSDART00000142270 Nonsense 208 814 8 21
Genomic Location (Zv9):
Chromosome 18 (position 6924733)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7502423
GRCz11 18 7461358
KASP Assay ID:
554-0525.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAAAGCCCTGGCTGCAAGAAGTGGCATTACCCAGGGCAGAGCTGGCA[C/T]AACCCTTATGCTCATTTATTGGAATGACTGTGGCAAACAATCGTAAGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081468 Nonsense 725 814 17 19
ENSDART00000142270 Nonsense 725 814 19 21
Genomic Location (Zv9):
Chromosome 18 (position 6937543)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7515233
GRCz11 18 7474168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCCTTTCCCCCTTATCCTGCATTTTCTCTTAGGCCCTGACGTGAAA[C/T]AGTGGACGGATCACAGACATCTCAAGAAAAGCTCTGAAGACGCTCGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081468 Nonsense 804 814 19 19
ENSDART00000142270 Nonsense 804 814 21 21
Genomic Location (Zv9):
Chromosome 18 (position 6940654)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7518344
GRCz11 18 7477279
KASP Assay ID:
554-5398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATTCGNNTTTTTTTCTCTCTCTCTTTTACTGACAGAAAGCCAAAGCC[C/T]AGGGTGTGGATCTGTCTGTTGCARAGGCCTTATAAACATCACCGAYTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link