si:ch211-274f20.2

Ensembl ID:
ENSDARG00000058579
ZFIN ID:
ZDB-GENE-091204-91
Human Orthologues:
CANX, CLGN
Human Descriptions:
calmegin [Source:HGNC Symbol;Acc:2060]
calnexin [Source:HGNC Symbol;Acc:1473]
Mouse Orthologues:
Canx, Clgn
Mouse Descriptions:
calmegin Gene [Source:MGI Symbol;Acc:MGI:107472]
calnexin Gene [Source:MGI Symbol;Acc:MGI:88261]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28263 Nonsense Mutation detected in F1 DNA During 2018
sa7400 Missense Mutation detected in F1 DNA During 2018
sa45507 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081458 Nonsense 218 469 6 14
ENSDART00000133904 Nonsense 242 452 7 13
Genomic Location (Zv9):
Chromosome 14 (position 9106265)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8710747
GRCz11 14 9016761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCTTTTGGAAGATATGGACACACCAGTGGCGTCTTCTGACCAAAAA[C/T]AAGAACATTTAACAAATGAAGCCTCTGATCTAAACTTGGAGCAACATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081458 Missense 291 469 10 14
ENSDART00000133904   None 452 None 13
Genomic Location (Zv9):
Chromosome 14 (position 9108983)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8713465
GRCz11 14 9019479
KASP Assay ID:
554-4265.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAAAACTCAATTAGAGAAAAAGATRTTTTWAAAAAWCTGATAAACC[C/A]TGAAGACAGACCCTGTAATGCTGCAATKTAAGTCAGTTCTATATGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081458 Essential Splice Site 402 469 12 14
ENSDART00000133904   None 452 None 13
Genomic Location (Zv9):
Chromosome 14 (position 9111284)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8715766
GRCz11 14 9021780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGAAGACACATGGGGCCAGAGACAGACAGTAAGATGTTCAGCAGATG[T/C]TGTCCAGGCCAAATGATCTTTAAAATACGCCTGGCAAAATTTGGTATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link