
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
abcg2c
- Ensembl ID:
- ENSDARG00000058574
- ZFIN ID:
- ZDB-GENE-050517-37
- Description:
- ATP-binding cassette, sub-family G (WHITE), member 2c [Source:RefSeq peptide;Acc:NP_001034728]
- Human Orthologue:
- ABCG2
- Human Description:
- ATP-binding cassette, sub-family G (WHITE), member 2 [Source:HGNC Symbol;Acc:74]
- Mouse Orthologues:
- Abcg2, Abcg3
- Mouse Descriptions:
- ATP-binding cassette, sub-family G (WHITE), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347061]
- ATP-binding cassette, sub-family G (WHITE), member 3 Gene [Source:MGI Symbol;Acc:MGI:1351624]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7378 | Missense | Mutation detected in F1 DNA | During 2018 |
sa22207 | Nonsense | Available for shipment | Available now |
sa7377 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7378
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032322 | 1 | 634 | 2 | 16 | |
ENSDART00000091806 | 1 | 263 | 2 | 7 | |
ENSDART00000141790 | Missense | 15 | 185 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 13 (position 4738954)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 4933732 GRCz11 13 5062318 - KASP Assay ID:
- 554-4319.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGAGATTTTATTTTTGTTCATTTCAATCTTCCTTCAGGCAGAGGAAGGCA[T/A]CATGCTGGATGAGGTGGTTGTGAATGAGCAGTCGTCCACAGATGCGGAWG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22207
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032322 | None | 634 | None | 16 | |
ENSDART00000091806 | Nonsense | 228 | 263 | 6 | 7 |
ENSDART00000141790 | None | 185 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 13 (position 4724825)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 4919603 GRCz11 13 5048189 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACACTGCCAACTCCATCATGGAGCTCCTGCAGAAGTACAAAATCTCATA[T/A]CAAATATACCTGCCTCCCGCTGCAAGCAATAATAAAGTATGCCTTTTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7377
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032322 | None | 634 | None | 16 | |
ENSDART00000091806 | Missense | 233 | 263 | 6 | 7 |
ENSDART00000141790 | None | 185 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 13 (position 4724812)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 4919590 GRCz11 13 5048176 - KASP Assay ID:
- 554-4318.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCATCATGGAGCTCCTGCAGAAGTACAAAATCTCATATCAAATATWCCTG[C/T]CTCCCGCTGCAAGCAATAATAAAGTATGCCTTTTAAAAACACTTTCTTCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cardiovascular disease risk factors: Genetic variants in LPL, OASL and TOMM40/APOE-C1-C2-C4 genes are associated with multiple cardiovascular-related traits. (View Study)
- Dental caries: GWAS of dental caries patterns in the permanent dentition. (View Study)
- Lipoprotein-associated phospholipase A2 activity change in response to statin therapy: Genome-wide association study evaluating lipoprotein-associated phospholipase A2 mass and activity at baseline and after rosuvastatin therapy. (View Study)
- Renal function-related traits (urea): Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations. (View Study)
- Response to statin therapy (LDL-C): Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial. (View Study)
- Urate levels: Association of three genetic loci with uric acid concentration and risk of gout: a genome-wide association study. (View Study)
- Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
- Urate levels: Multiple genetic loci influence serum urate levels and their relationship with gout and cardiovascular disease risk factors. (View Study)
- Uric acid levels: Genome-wide association of serum uric acid concentration: replication of sequence variants in an island population of the Adriatic coast of Croatia. (View Study)
- Uric acid levels: Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: