ENSDARG00000058556
- Ensembl ID:
- ENSDARG00000058556
- Human Orthologues:
- MUC5AC, MUC6
- Human Descriptions:
- mucin 5AC, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7515]
- mucin 6, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7517]
- Mouse Orthologues:
- Muc5ac, Muc5b, Muc6
- Mouse Descriptions:
- mucin 5, subtype B, tracheobronchial Gene [Source:MGI Symbol;Acc:MGI:1921430]
- mucin 5, subtypes A and C, tracheobronchial/gastric Gene [Source:MGI Symbol;Acc:MGI:104697]
- mucin 6, gastric Gene [Source:MGI Symbol;Acc:MGI:2663233]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa927 |
Nonsense |
Available for shipment |
Available now |
sa44237 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa38012 |
Nonsense |
Available for shipment |
Available now |
sa25223 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44238 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa7537 |
Missense |
Mutation detected in F1 DNA |
During 2018 |
sa44239 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa24614 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa927
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Nonsense |
231 |
1989 |
5 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8624003)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8338908 |
GRCz11 |
25 |
8415976 |
- KASP Assay ID:
- 554-0832.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AATGTTACGGCAGCCATGACTGTCTGTGCAACACGCTAACAGAGATCTCA[C/T]GACAATGCACACATGCTGGAGGACAACCAGGAACATGGAGGACAGAACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44237
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Essential Splice Site |
561 |
1989 |
12 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8626021)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8340926 |
GRCz11 |
25 |
8417994 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCCTTTTCTGCATGTCATTCAGAAATATGCCCAAAGATTTACTATGAAG[T/C]GAGTTCTTTTGTATATTTCCTTTTGAAATGAACTATATACAGTATTTATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38012
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Nonsense |
636 |
1989 |
14 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8626427)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8341332 |
GRCz11 |
25 |
8418400 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGCTGTGGCCTCACCTGCCGTTCTCTCAGTGGACAAGAAAACACCTGC[C/T]AAGGGTCCTTCACGCCTGTAGATGGCTGTGTTTGTTCTGAGGGAACCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25223
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Essential Splice Site |
790 |
1989 |
18 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8627475)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8342380 |
GRCz11 |
25 |
8419448 |
- KASP Assay ID:
- 554-7465.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGGTGCAAACCATTAAAAGGCTGAATCTATGAATTATGTCTATATTAC[A/G]GCACATGCAGAAATGGGATGTGGGATTGCACGGAAAAAGAGTGTTACGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44238
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Essential Splice Site |
836 |
1989 |
18 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8627616)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8342521 |
GRCz11 |
25 |
8419589 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGCAAGAAATATTCTTTCCATGGAGACTGTGAACAAATCTTAGTCCAT[G/A]TATGTTTTGCATCAATTTTGGCCTTTCCAAGTTAGAAAGAAAATTAGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7537
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > G
- Consequence:
- Missense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Missense |
1762 |
1989 |
38 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8648479)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8363384 |
GRCz11 |
25 |
8440452 |
- KASP Assay ID:
- 554-4050.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTSTTCTGTCTAGTGCCGAAAGACGTTTGTGTGCACAATAACACTGAGT[A/G]TCAGGTGAGTTGYTGAGTTTATASTAACTAGTAACACCAACAGTAAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44239
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Nonsense |
1827 |
1989 |
40 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8648970)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8363875 |
GRCz11 |
25 |
8440943 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAACAAGAAGGAGAGTGTTGTGGAACGTGCAAGCAGAAGTCCTGTATTTA[T/A]ACAGCGCCAGATAACACCACTCACACTCTTCAGGTACAAACCTTTCTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24614
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000081428 |
Essential Splice Site |
1879 |
1989 |
41 |
45 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8649229)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
25 |
8364134 |
GRCz11 |
25 |
8441202 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAGATCAAACCTAAATGCCCTGACTTTAATCCTGATGACTGTGAGGCT[G/T]TAAGTAGTGGTTGATAAGATATTACCATTAATCAAATTTCCACTTTGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: