si:dkey-254e1.1

Ensembl ID:
ENSDARG00000058508
ZFIN ID:
ZDB-GENE-091204-50
Human Orthologue:
TTC18
Human Description:
tetratricopeptide repeat domain 18 [Source:HGNC Symbol;Acc:30726]
Mouse Orthologue:
Ttc18
Mouse Description:
tetratricopeptide repeat domain 18 Gene [Source:MGI Symbol;Acc:MGI:1923920]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9230 Essential Splice Site Mutation detected in F1 DNA During 2018
sa504 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081374 Essential Splice Site 118 1050 4 26
ENSDART00000132238 Essential Splice Site 36 968 2 24
Genomic Location (Zv9):
Chromosome 3 (position 13049287)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12081512
GRCz11 3 12021712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAACTTAACACATTAKTATTGATCCTCATGTTTGATATCTTATTCTA[G/T]GWCAATGTAACTTCTCCTCCAYTGTGCTCCTTCATGCCGTGACTGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081374 Nonsense 457 1050 12 26
ENSDART00000132238 Nonsense 375 968 10 24
Genomic Location (Zv9):
Chromosome 3 (position 13036845)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12069070
GRCz11 3 12009270
KASP Assay ID:
554-0223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAACACTCTTGTTATAGAGTGAATTTTTTATTATCCTCTCAGATGTA[C/A]GCCGATTCAAGATCATACATTATTATCGACATTTTTGTGGAAAAGCCACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link