slc9a3.1

Ensembl ID:
ENSDARG00000058498
ZFIN ID:
ZDB-GENE-060503-545
Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 3.1 [Source:RefSeq peptide;Acc:NP_00110
Human Orthologue:
SLC9A3
Human Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 3 [Source:HGNC Symbol;Acc:11073]
Mouse Orthologue:
Slc9a3
Mouse Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 3 Gene [Source:MGI Symbol;Acc:MGI:105064

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9612 Nonsense Available for shipment Available now
sa39236 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43241 Nonsense Mutation detected in F1 DNA During 2018
sa23464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081350 Nonsense 156 832 2 18
ENSDART00000121638 Nonsense 156 832 2 17
ENSDART00000126033 Nonsense 156 704 2 13
Genomic Location (Zv9):
Chromosome 19 (position 11341349)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10800578
GRCz11 19 10719503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGAAACTTGGGTGCTATTCTTATTTATGCCATCTTTGGSACGTGCTG[G/A]AACGCAGCTGCTGTAGGACTCTCTCTGTGGGSCTGCCATGAAGCGGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081350 Essential Splice Site 174 832 2 18
ENSDART00000121638 Essential Splice Site 174 832 2 17
ENSDART00000126033 Essential Splice Site 174 704 2 13
Genomic Location (Zv9):
Chromosome 19 (position 11341293)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10800522
GRCz11 19 10719447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCTGTAGGACTCTCTCTGTGGGGCTGCCATGAAGCGGGAGCAATGG[G/A]TAAATTCAGTTCTGTTATTTTCTGCATTCCCGCTATTCTGATAAATATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081350 Nonsense 414 832 7 18
ENSDART00000121638 Nonsense 414 832 7 17
ENSDART00000126033 Nonsense 414 704 7 13
Genomic Location (Zv9):
Chromosome 19 (position 11330771)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10790000
GRCz11 19 10708925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCCGATTGGTCCCCGTGGAGCTGATTGACCAGGTGGTGATGAGCTA[C/A]GGTGGCCTGCGGGGGGCAGTGGCGTACGGTCTGGCAGCAATGCTGGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081350 Nonsense 767 832 16 18
ENSDART00000121638 Nonsense 767 832 16 17
ENSDART00000126033   None 704 None 13
Genomic Location (Zv9):
Chromosome 19 (position 11319950)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10779179
GRCz11 19 10698104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCAGACATGGACAGCCCAGTTCACAGTCCAGTTCATAGTCCACCATG[G/A]CTGCTGGAGACTGAGATGAGCGTCGCTCCTTCCCAGAGGGCTCAGCGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link