si:dkey-30c15.17

Ensembl ID:
ENSDARG00000058492
ZFIN ID:
ZDB-GENE-060503-450
Description:
Novel carboxylesterase domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LX38]
Human Orthologues:
ACHE, BCHE
Human Descriptions:
acetylcholinesterase [Source:HGNC Symbol;Acc:108]
butyrylcholinesterase [Source:HGNC Symbol;Acc:983]
Mouse Orthologues:
Ache, Bche
Mouse Descriptions:
acetylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:87876]
butyrylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:894278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1152 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081371   None 421 None 7
ENSDART00000133375 Nonsense 113 238 2 4
Genomic Location (Zv9):
Chromosome 18 (position 6830919)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7408609
GRCz11 18 7367544
KASP Assay ID:
554-1063.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGGACTGCCTTTACCTAAATGTGTTTGTTCCTGTGAGTGTCAACCTGT[C/A]GCTGCCAAAAGTAACAGCACTACCAGTTATGGTGTGGATTCATGGCGGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link