
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:7136778
- Ensembl ID:
- ENSDARG00000058470
- ZFIN ID:
- ZDB-GENE-041111-17
- Human Orthologue:
- MAPK13
- Human Description:
- mitogen-activated protein kinase 13 [Source:HGNC Symbol;Acc:6875]
- Mouse Orthologue:
- Mapk13
- Mouse Description:
- mitogen-activated protein kinase 13 Gene [Source:MGI Symbol;Acc:MGI:1346864]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9763 | Essential Splice Site | Available for shipment | Available now |
sa34327 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9763
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081341 | Essential Splice Site | 146 | 362 | 5 | 12 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11865759)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 10803365 GRCz11 8 10841070 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTGTCTCCACTCCACAGTACATTCATGGCGCTGGCATCATTCACAGAG[T/C]AAGTGAGACTGGCAGTGAATAAACAGCATCTGCTCAKAATTATCATTTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34327
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081341 | Nonsense | 231 | 362 | 9 | 12 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11854674)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 10814450 GRCz11 8 10852155 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCATGCATTGTCTTTAACTTCTGACATTCAGACATGGATCAGCTGACT[C/T]AGATAATGAAAGTTGCAGGAACACCAGGCCCAGAATTCGTGGAGAAGCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: