
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-14k19.5
- Ensembl ID:
- ENSDARG00000058460
- ZFIN ID:
- ZDB-GENE-090312-124
- Human Orthologue:
- CACNG3
- Human Description:
- calcium channel, voltage-dependent, gamma subunit 3 [Source:HGNC Symbol;Acc:1407]
- Mouse Orthologue:
- Cacng3
- Mouse Description:
- calcium channel, voltage-dependent, gamma subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1859165]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38243 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38243
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000055023 | Essential Splice Site | 71 | 330 | 1 | 5 |
ENSDART00000146303 | Essential Splice Site | 71 | 309 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 1 (position 8158713)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 8398518 GRCz11 1 9082629 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGAGGTGCTGACGCATTCAGGACTCTGGAGACAGTGCTGCATGGAAGG[T/A]ACTTTTTGTGTTTTCAGAAAGTAGTTAACATGCTTTTATTGCATGTTTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: