zgc:101876

Ensembl ID:
ENSDARG00000058458
ZFIN ID:
ZDB-GENE-041010-37
Description:
hypothetical protein LOC449790 [Source:RefSeq peptide;Acc:NP_001005963]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26003 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081328 Essential Splice Site 67 502 2 9
Genomic Location (Zv9):
Chromosome 3 (position 12497428)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12618221
GRCz11 3 12769670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAATACCTTTAATTTAAATGCCTGTAAAGTCTCTTTTACTTTTTTATC[A/T]GATGGCAAAGCAGTTCGGCCCAGTTTTTAAAGTCTACTTTGGTCCGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link