
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arnt2
- Ensembl ID:
- ENSDARG00000058449
- ZFIN ID:
- ZDB-GENE-001207-3
- Description:
- Aryl hydrocarbon receptor nuclear translocator 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9DG12]
- Human Orthologue:
- ARNT2
- Human Description:
- aryl-hydrocarbon receptor nuclear translocator 2 [Source:HGNC Symbol;Acc:16876]
- Mouse Orthologue:
- Arnt2
- Mouse Description:
- aryl hydrocarbon receptor nuclear translocator 2 Gene [Source:MGI Symbol;Acc:MGI:107188]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20863 | Nonsense | Available for shipment | Available now |
sa15572 | Nonsense | Available for shipment | Available now |
sa20864 | Essential Splice Site | Available for shipment | Available now |
sa11162 | Nonsense | Available for shipment | Available now |
sa20865 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20863
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129575 | Nonsense | 270 | 738 | 8 | 20 |
ENSDART00000130997 | Nonsense | 119 | 586 | 3 | 15 |
The following transcripts of ENSDARG00000058449 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 11591830)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 10532182 GRCz11 7 10773822 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTTGTTTCAGGTGTGGCAGTGCACCTTTGGATCACATCTCATTGAAT[C/T]GATTGTCCAGCATGAGAAAGAGATACAGGTATGTTTGAAAGATTCACTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15572
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129575 | Nonsense | 368 | 738 | 11 | 20 |
ENSDART00000130997 | Nonsense | 217 | 586 | 6 | 15 |
The following transcripts of ENSDARG00000058449 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 11614265)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 10554617 GRCz11 7 10796257 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATTCCTTTCRCGCCACAATTCGGATGGCATCWTCACAKTYGTGGACCCT[C/T]GATGCATCAACGTGATTGGCTACCAACCTCAGGTCATTATCACMTTGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20864
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129575 | Essential Splice Site | 404 | 738 | 13 | 20 |
ENSDART00000130997 | Essential Splice Site | 253 | 586 | 8 | 15 |
The following transcripts of ENSDARG00000058449 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 11638530)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 10578882 GRCz11 7 10820522 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAATGGGGACAATAAAGTGTAAACAAACAAACAAATGTTTCTTGTGAAT[A/G]GGTGGTGAAGCTGAAAGGCCAGGTTCTCTCAGTGATGTACCGCTTCCGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11162
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129575 | Nonsense | 524 | 738 | 16 | 20 |
ENSDART00000130997 | Nonsense | 373 | 586 | 11 | 15 |
The following transcripts of ENSDARG00000058449 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 11665279)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 10605631 GRCz11 7 10847271 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTCTCNNNGATGATGTWTTGTGTGTKTTTATGTGTGTTCAGCTGAAAAG[A/T]ARATGATGGTTCCCTCATCCACCTCTGGCGGGCAGCAGTTGTATTCTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20865
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129575 | Essential Splice Site | 658 | 738 | None | 20 |
ENSDART00000130997 | Essential Splice Site | 506 | 586 | None | 15 |
The following transcripts of ENSDARG00000058449 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 11672899)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 10613251 GRCz11 7 10854891 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCTCCGGAAACGCCTACTCCAACCTCGCCAATCGCAACACTGCTTTCGG[T/A]AAGAAAATCTGCTCATTCATTATAATACATGACTACATTGCTCATTGATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: