zrsr2

Ensembl ID:
ENSDARG00000058448
ZFIN ID:
ZDB-GENE-030131-1495
Human Orthologues:
ZRSR1, ZRSR2
Human Descriptions:
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1 [Source:HGNC Symbol;Acc:12456]
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2 [Source:HGNC Symbol;Acc:23019]
Mouse Orthologues:
Zrsr1, Zrsr2
Mouse Descriptions:
zinc finger (CCCH type), RNA binding motif and serine/arginine rich 1 Gene [Source:MGI Symbol;Acc:MG
zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38832 Nonsense Mutation detected in F1 DNA During 2018
sa41794 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081319 Nonsense 307 635 10 11
Genomic Location (Zv9):
Chromosome 11 (position 12796837)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12681246
GRCz11 11 12738905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCAATGCAAAGAAGCTTTTGTGATGTTTAATGGTCGCTGGTATGCT[G/T]GAAGACAACTGCAATGTGAATTCTCCCCTGTGACTAGATGGAAAACGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081319 Nonsense 309 635 10 11
Genomic Location (Zv9):
Chromosome 11 (position 12796831)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12681240
GRCz11 11 12738899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCAAAGAAGCTTTTGTGATGTTTAATGGTCGCTGGTATGCTGGAAGA[C/T]AACTGCAATGTGAATTCTCCCCTGTGACTAGATGGAAAACGGCCATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link