zgc:136472

Ensembl ID:
ENSDARG00000058445
ZFIN ID:
ZDB-GENE-060421-2552
Description:
protein disulfide-isomerase-like protein of the testis [Source:RefSeq peptide;Acc:NP_001035331]
Human Orthologue:
PDILT
Human Description:
protein disulfide isomerase-like, testis expressed [Source:HGNC Symbol;Acc:27338]
Mouse Orthologue:
Pdilt
Mouse Description:
protein disulfide isomerase-like, testis expressed Gene [Source:MGI Symbol;Acc:MGI:1919080]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18316 Nonsense Available for shipment Available now
sa32593 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055011 Nonsense 13 510 1 11
Genomic Location (Zv9):
Chromosome 1 (position 8325940)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8565745
GRCz11 1 9249856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCAGGCAGTATGAAGGTGGASGTTACGTTGYGTTTRATTGTGTGYT[T/A]ATTTTTACACCAAACTCTGGCCGRGAGTCAATCARATTCAATCGTCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055011 Nonsense 202 510 4 11
Genomic Location (Zv9):
Chromosome 1 (position 8320624)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8560429
GRCz11 1 9244540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTGCCGATCTGCCGTTTGGAGTAACGAGACATCATGAAGTTTTCAGC[A/T]AGTTTGAGATCAGCAGAGACTCTGTTCTCCTCATCAGAAAGGTCAGCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link