slc6a6

Ensembl ID:
ENSDARG00000058440
ZFIN ID:
ZDB-GENE-030131-3077
Description:
solute carrier family 6, member 6 [Source:RefSeq peptide;Acc:NP_001032750]
Human Orthologue:
SLC6A6
Human Description:
solute carrier family 6 (neurotransmitter transporter, taurine), member 6 [Source:HGNC Symbol;Acc:11
Mouse Orthologue:
Slc6a6
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, taurine), member 6 Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24206 Essential Splice Site Available for shipment Available now
sa37556 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8569 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24205 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064082 Essential Splice Site 204 500 4 11
Genomic Location (Zv9):
Chromosome 22 (position 34312087)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31596636
GRCz11 22 31513550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGCGAACGCCACTAACTTCACGTCCCCCGTCACTGAGTTCTGGGAG[T/C]AAGTATATGTTAATCAAGTACACATTTGTAAGTCATCCCGAAAAGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064082 Essential Splice Site 293 500 6 11
Genomic Location (Zv9):
Chromosome 22 (position 34308019)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31592568
GRCz11 22 31509482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAAATTTTATCTGTACCCAAATGTGACTCGCCTCGGAGACCCAGAGG[T/G]AAGATCTCATGGCTATTAACATGTCTCCTCAAGATGCTTTACAATATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064082 Essential Splice Site 328 500 7 11
Genomic Location (Zv9):
Chromosome 22 (position 34307314)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31591863
GRCz11 22 31508777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGACGTCACTGGGAAGCTACAACAAGTACAAATACAACTGCTACAG[G/A]TGGGTTTCGATACCCCGGGGCTGGGAGGGGGGCTTAGTCMAGTCAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064082 Nonsense 496 500 11 11
Genomic Location (Zv9):
Chromosome 22 (position 34300392)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31584941
GRCz11 22 31501855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTGCTGTAGCCTGGGTTTATGGTGAGTACAAGACTTGCACAACTTA[T/A]AATGGGGTTATGTAGTTGTAGCATCTCTTGAAATGGGTGTTTCATTACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link