
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-167j6.5
- Ensembl ID:
- ENSDARG00000058409
- ZFIN ID:
- ZDB-GENE-070912-147
- Human Orthologue:
- ASTL
- Human Description:
- astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
- Mouse Orthologue:
- Astl
- Mouse Description:
- astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34572 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa45348 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34572
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081270 | Nonsense | 99 | 289 | 4 | 8 |
ENSDART00000136417 | Nonsense | 29 | 215 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13172656)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 12925221 GRCz11 9 12896424 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGTCCAGGATCCCGCAGTGCCATTACCTGTCTAGGAGATTCCTGCCGCT[G/A]GCCCAAAGCTGTGGACGGATTTGTGTATGTACCATACATCATGTCCACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45348
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081270 | Nonsense | 158 | 289 | 6 | 8 |
ENSDART00000136417 | Nonsense | 88 | 215 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13175262)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 12927827 GRCz11 9 12899030 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTTTATTTATTTACTAATAAAATACCTCACTGTTTGTCCCGTCAGCTG[C/A]TGGTCATATCTGGGAATGACAGGAGGCAGTCAGACGGTCTCTCTGCAGTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: