zgc:123262

Ensembl ID:
ENSDARG00000058390
ZFIN ID:
ZDB-GENE-051113-136
Description:
acyl-CoA thioesterase like [Source:RefSeq peptide;Acc:NP_001032476]
Human Orthologue:
ACOT9
Human Description:
acyl-CoA thioesterase 9 [Source:HGNC Symbol;Acc:17152]
Mouse Orthologues:
Acot10, Acot9
Mouse Descriptions:
acyl-CoA thioesterase 10 Gene [Source:MGI Symbol;Acc:MGI:1928940]
acyl-CoA thioesterase 9 Gene [Source:MGI Symbol;Acc:MGI:1928939]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44135 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37888 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058948 Essential Splice Site 5 425 1 15
Genomic Location (Zv9):
Chromosome 24 (position 22559790)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21806668
GRCz11 24 21951842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTCCCCAAGCGGCAAGGGAAGAATAAAAAGATGTTTTGTCCACGG[T/G]GAGTGTTAAATAGACATTTTCCGATTTTGTTTTAATCTGTAAGGCTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058948 Nonsense 259 425 10 15
Genomic Location (Zv9):
Chromosome 24 (position 22550716)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21797594
GRCz11 24 21942768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTGAAAGTGGCTCCTACAGCAGAGGAGAGGACACTCATTCACAAC[C/T]AGTTCCTCAACACTCTTGACACACGGTCCATTTATGAGCATTACACAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link