zgc:136403

Ensembl ID:
ENSDARG00000058372
ZFIN ID:
ZDB-GENE-060421-6122
Description:
Zgc:136403 [Source:UniProtKB/TrEMBL;Acc:Q1RM66]
Human Orthologue:
MCPH1
Human Description:
microcephalin 1 [Source:HGNC Symbol;Acc:6954]
Mouse Orthologue:
Mcph1
Mouse Description:
microcephaly, primary autosomal recessive 1 Gene [Source:MGI Symbol;Acc:MGI:2443308]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35414 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31904 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102937 Essential Splice Site 155 422 7 15
ENSDART00000122491 Essential Splice Site 196 470 7 9
Genomic Location (Zv9):
Chromosome 13 (position 6217039)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6192097
GRCz11 13 6320557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGATTGAAAGAAATGAAAGCTGGACGTGAACATCTCTCACCCACTGG[T/C]ACCCTATTTCCTTCATATTTTTGTAGCATGTATGTTTTTTAGACCGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102937 Essential Splice Site 233 422 10 15
ENSDART00000122491   None 470 None 9
Genomic Location (Zv9):
Chromosome 13 (position 6220959)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6188177
GRCz11 13 6316637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAATGTGTAGCAAAGTGGAGAATATGAAAAAGGACAAATGCTTGAAGG[T/G]AAAATGCTGGAGTTTTTTTTCCATGTTTAGTAGATTGTATTAAAGTTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link