zgc:158350

Ensembl ID:
ENSDARG00000058369
ZFIN ID:
ZDB-GENE-030131-2628
Description:
RNA-binding protein MEX3B [Source:RefSeq peptide;Acc:NP_001074462]
Human Orthologue:
MEX3B
Human Description:
mex-3 homolog B (C. elegans) [Source:HGNC Symbol;Acc:25297]
Mouse Orthologue:
Mex3b
Mouse Description:
mex3 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1918252]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40841 Nonsense Mutation detected in F1 DNA During 2018
sa12081 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101537 Nonsense 163 537 2 2
Genomic Location (Zv9):
Chromosome 7 (position 12883170)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 11811284
GRCz11 7 12064245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCGCCCAATCTCCCTGGTCAGACCACCATCCAGGTGCGGGTGCCCTA[T/A]CGGGTGGTGGGGCTGGTGGTCGGACCCAAGGGGGCCACCATCAAGCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101537 Nonsense 351 537 2 2
Genomic Location (Zv9):
Chromosome 7 (position 12882607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 11810721
GRCz11 7 12063682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGCGAGGTGATCTCGCCAGATTGCACTGACTTGACCTTCGAGTCGT[C/A]GCCAGGATTTGATCCTACTCCTGCGCCGCCAGGCTTGATGTGGTCGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link