ankrd33ba

Ensembl ID:
ENSDARG00000058357
ZFIN ID:
ZDB-GENE-040724-39
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q7T168]
Human Orthologue:
ANKRD33B
Human Description:
ankyrin repeat domain 33B [Source:HGNC Symbol;Acc:35240]
Mouse Orthologue:
Ankrd33b
Mouse Description:
ankyrin repeat domain 33B Gene [Source:MGI Symbol;Acc:MGI:1917904]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30096 Nonsense Mutation detected in F1 DNA During 2018
sa44136 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081220 Nonsense 402 510 4 4
ENSDART00000132390 Nonsense 262 370 3 3
Genomic Location (Zv9):
Chromosome 24 (position 22666959)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21913837
GRCz11 24 22059011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTTTCAGAACTCCCGCGTCCTGCTGGTGCCCAAACCGAAAGATCGG[C/T]GAGCGAGTTTACAGCCTAATGCTCAAGCAGAGGATTCATCCACACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081220 Nonsense 414 510 4 4
ENSDART00000132390 Nonsense 274 370 3 3
Genomic Location (Zv9):
Chromosome 24 (position 22666996)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21913874
GRCz11 24 22059048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAAAGATCGGCGAGCGAGTTTACAGCCTAATGCTCAAGCAGAGGATT[C/A]ATCCACACTGACCATCCGCAGGACCAGTCTACTGCCATTACACCTGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link