
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
elovl1b
- Ensembl ID:
- ENSDARG00000058356
- ZFIN ID:
- ZDB-GENE-040426-2755
- Description:
- elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1b [Source:RefSeq pept
- Human Orthologue:
- ELOVL1
- Human Description:
- elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 [Source:HGNC Symbol;A
- Mouse Orthologue:
- Elovl1
- Mouse Description:
- elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene [Source:MGI Symb
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21866 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21866
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081216 | Nonsense | 70 | 320 | 3 | 8 |
ENSDART00000128923 | Nonsense | 70 | 244 | 3 | 8 |
ENSDART00000138377 | Nonsense | 70 | 130 | 6 | 8 |
ENSDART00000139765 | Nonsense | 70 | 243 | 5 | 10 |
ENSDART00000145726 | Nonsense | 70 | 129 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 11 (position 13289859)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 13046682 GRCz11 11 13104341 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCATGGCCAACCGTAAACCCTTTCAGCTGAAAGAAGCCATGATCATCTA[C/A]AACCTGTCCTTAGTCGGCCTGTCTGCATATATCGTATATGAGGTGAGTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: