scinlb

Ensembl ID:
ENSDARG00000058348
ZFIN ID:
ZDB-GENE-040426-2068
Description:
scinderin like b [Source:RefSeq peptide;Acc:NP_998255]
Human Orthologue:
SCIN
Human Description:
scinderin [Source:HGNC Symbol;Acc:21695]
Mouse Orthologue:
Scin
Mouse Description:
scinderin Gene [Source:MGI Symbol;Acc:MGI:1306794]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19686 Nonsense Available for shipment Available now
sa32850 Nonsense Mutation detected in F1 DNA During 2018
sa25764 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45090 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 169 720 5 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10220415)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10645511
GRCz11 2 10429110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATATGTTTTAGTCATTCTTTTTGTTTTTTTCCCTCAGGATATTTA[T/G]CAGTGGTGTGGCAGTGGCTGCAACCGATTTGAGCGTCTGAAAGCCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 178 720 5 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10220390)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10645486
GRCz11 2 10429085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTTTCCCTCAGGATATTTATCAGTGGTGTGGCAGTGGCTGCAAC[C/T]GATTTGAGCGTCTGAAAGCCTCCAAGCTGGCTATTGATATCCGGGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Essential Splice Site 290 720 7 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10215316)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10640412
GRCz11 2 10424011
KASP Assay ID:
2259-1626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTACATCCTAGACAATGGAGTCGACAACAATGTGTTTGTGTGGAAAG[G/A]TGCGTCGCATGTGTGTTCATTTTAAAATCAGCATGGAATCACGATTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 437 720 11 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10207259)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10632355
GRCz11 2 10415954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCTGTGGTGTGTTTGCAGCATGTGAACAGAGTGTGATTGTGTTTCAG[G/A]CAGGGGCTGAAGTGCACTCAGGACGAGCTGGCAGCTTCTGCTTTCCTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link