sass6

Ensembl ID:
ENSDARG00000058346
ZFIN ID:
ZDB-GENE-040426-2784
Description:
Spindle assembly abnormal protein 6 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVT3]
Human Orthologue:
SASS6
Human Description:
spindle assembly 6 homolog (C. elegans) [Source:HGNC Symbol;Acc:25403]
Mouse Orthologue:
Sass6
Mouse Description:
spindle assembly 6 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1920026]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43780 Nonsense Mutation detected in F1 DNA During 2018
sa5967 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45755 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081191 Nonsense 354 627 9 17
Genomic Location (Zv9):
Chromosome 22 (position 10854980)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10715148
GRCz11 22 10744830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGACCAGCTTGTGCTGAGGACCAAAGAAGTGCTGGAGGCCACGCAG[C/T]AGCAGAAGGTTAGAGAGCTTTGTGTGTGTGTGTGTGTGTGTGTATTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081191 Essential Splice Site 356 627 9 17
Genomic Location (Zv9):
Chromosome 22 (position 10854971)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10715139
GRCz11 22 10744821
KASP Assay ID:
554-3839.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTGTGCTGAGGACCAAAGAAGTGCTGGAGGCCACGCAGCAGCAGAAG[G/A]TTAGAGAGCTTTGTGTGTGTGTGTGTGTGTGTGTATTGGTAAATTATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081191 Nonsense 477 627 13 17
Genomic Location (Zv9):
Chromosome 22 (position 10851058)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10711226
GRCz11 22 10740908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTTTCTCATGTGTATTTTCTGTTTTTCTGTCCCTCAGTAATAACGTG[G/A]CTGAACAAGCAGCTGAATGAGAATCAGCTCTCCAGAAAGCAGGAAACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link