
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sass6
- Ensembl ID:
- ENSDARG00000058346
- ZFIN ID:
- ZDB-GENE-040426-2784
- Description:
- Spindle assembly abnormal protein 6 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVT3]
- Human Orthologue:
- SASS6
- Human Description:
- spindle assembly 6 homolog (C. elegans) [Source:HGNC Symbol;Acc:25403]
- Mouse Orthologue:
- Sass6
- Mouse Description:
- spindle assembly 6 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1920026]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43780 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa5967 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa45755 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43780
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081191 | Nonsense | 354 | 627 | 9 | 17 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10854980)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10715148 GRCz11 22 10744830 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAAAGACCAGCTTGTGCTGAGGACCAAAGAAGTGCTGGAGGCCACGCAG[C/T]AGCAGAAGGTTAGAGAGCTTTGTGTGTGTGTGTGTGTGTGTGTATTGGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5967
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081191 | Essential Splice Site | 356 | 627 | 9 | 17 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10854971)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10715139 GRCz11 22 10744821 - KASP Assay ID:
- 554-3839.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCTTGTGCTGAGGACCAAAGAAGTGCTGGAGGCCACGCAGCAGCAGAAG[G/A]TTAGAGAGCTTTGTGTGTGTGTGTGTGTGTGTGTATTGGTAAATTATACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45755
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081191 | Nonsense | 477 | 627 | 13 | 17 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10851058)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10711226 GRCz11 22 10740908 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTTTTTCTCATGTGTATTTTCTGTTTTTCTGTCCCTCAGTAATAACGTG[G/A]CTGAACAAGCAGCTGAATGAGAATCAGCTCTCCAGAAAGCAGGAAACTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: