
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-133j6.3
- Ensembl ID:
- ENSDARG00000058332
- ZFIN ID:
- ZDB-GENE-090312-205
- Description:
- LOC553479 protein [Source:UniProtKB/TrEMBL;Acc:Q502A4]
- Human Orthologues:
- AC090051.1, KRT18
- Human Descriptions:
- keratin 18 [Source:HGNC Symbol;Acc:6430]
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JEA8]
- Mouse Orthologue:
- Krt18
- Mouse Description:
- keratin 18 Gene [Source:MGI Symbol;Acc:MGI:96692]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45788 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11708 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45788
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081193 | Nonsense | 196 | 410 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 23 (position 10460482)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 10419284 GRCz11 23 10354254 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCAGACATAAATGCACTGAGAAAAATGCTGGATGACACCAATGTGGCA[C/T]GACTCCATCTGGAAAATGATGTTGAAGGATTAAAGGTAGAGCTCATCGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11708
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081193 | Essential Splice Site | 220 | 410 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 23 (position 10460687)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 10419489 GRCz11 23 10354459 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAAGGGGCCTAAGATATAACCCTGTGSAACATCAAATCACCTATTTTTC[A/T]GGAATTGTCAGCACTAWATGGTCAAATTACCCAATCAGGAGTGCAAGTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: