zgc:175268

Ensembl ID:
ENSDARG00000058318
ZFIN ID:
ZDB-GENE-080303-33
Description:
hypothetical protein LOC799425 [Source:RefSeq peptide;Acc:NP_001107934]
Human Orthologues:
C1QTNF9, RP11-45B20.2
Human Descriptions:
C1q and tumor necrosis factor related protein 9 [Source:HGNC Symbol;Acc:28732]
Complement C1q tumor necrosis factor-related protein 9B [Source:UniProtKB/Swiss-Prot;Acc:B2RNN3]
Mouse Orthologue:
C1qtnf9
Mouse Description:
C1q and tumor necrosis factor related protein 9 Gene [Source:MGI Symbol;Acc:MGI:3045252]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24500 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081178 Nonsense 226 336 3 5
ENSDART00000128687 Nonsense 229 339 3 3
Genomic Location (Zv9):
Chromosome 24 (position 22517056)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21763934
GRCz11 24 21909108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCAGATTAAGCGACAGCACCAAATTACCAGCCGCTAATGCTCCAATT[C/T]GATTTGATAGAGTCCTCTATAACAGTCAAGGTCACTATGATCCTGAAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link