zgc:77875

Ensembl ID:
ENSDARG00000058305
ZFIN ID:
ZDB-GENE-040426-1899
Description:
Novel protein (Zgc:77875) [Source:UniProtKB/TrEMBL;Acc:B0UXJ6]
Human Orthologue:
MTMR3
Human Description:
myotubularin related protein 3 [Source:HGNC Symbol;Acc:7451]
Mouse Orthologue:
Mtmr3
Mouse Description:
myotubularin related protein 3 Gene [Source:MGI Symbol;Acc:MGI:1921552]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18023 Nonsense Available for shipment Available now
sa18022 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081163   None 373 None 12
ENSDART00000126132 Nonsense 628 1170 15 19
ENSDART00000142177   None 438 None 11

The following transcripts of ENSDARG00000058305 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4151010)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3894041
GRCz11 8 3950747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGTTYGATAACTTGCCCAGTGCTTGTGAAGTKGGAAATCCACTAACAT[C/A]AAATCGACGTTCCAGTGACCCAAGTTTGAATGAGAAATGGCAGGACCAKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081163   None 373 None 12
ENSDART00000126132 Essential Splice Site 1047 1170 15 19
ENSDART00000142177   None 438 None 11

The following transcripts of ENSDARG00000058305 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4149751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3892782
GRCz11 8 3949488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGCTGCTGGGATGCTGCGGCTCAWCGGAGACATCRGAGATGAAGTG[G/A]TGAGCAGTCTTTTTGTTTGTTTNNNNATTTATTTTTCGCAACAAGGGACAGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link