zgc:113279

Ensembl ID:
ENSDARG00000058263
ZFIN ID:
ZDB-GENE-050522-529
Description:
hypothetical protein LOC553749 [Source:RefSeq peptide;Acc:NP_001018556]
Human Orthologue:
NFKBIZ
Human Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta [Source:HGNC Symb
Mouse Orthologue:
Nfkbiz
Mouse Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080958 Nonsense 420 487 8 10
Genomic Location (Zv9):
Chromosome 15 (position 16842729)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17917220
GRCz11 15 17853242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGACAGATCCTGAGAGGTTTAATGAAGAATGGCATGTATTTGAATT[T/A]GGAGGAAAGAGATGCGAATGGTAGGGCTACATGTCTGTATGTTATTTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link