zgc:174160

Ensembl ID:
ENSDARG00000058260
ZFIN ID:
ZDB-GENE-030131-6252
Description:
p90 autoantigen [Source:RefSeq peptide;Acc:NP_001107893]
Human Orthologue:
KIAA1524
Human Description:
KIAA1524 [Source:HGNC Symbol;Acc:29302]
Mouse Orthologue:
C330027C09Rik
Mouse Description:
RIKEN cDNA C330027C09 gene Gene [Source:MGI Symbol;Acc:MGI:2146335]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37901 Nonsense Mutation detected in F1 DNA During 2018
sa24512 Nonsense Available for shipment Available now
sa39454 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081043 Nonsense 657 896 16 21
Genomic Location (Zv9):
Chromosome 24 (position 25837424)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25084302
GRCz11 24 25229476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAGCCGTCTGCAGGACCTTTTGGAGGCCAAAGCGCTCGCACTGTCA[C/T]AGGCAGATCGGCTCATTGCTCAATACCGCTGTCAGAGAGCACAGGCGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081043 Nonsense 722 896 17 21
Genomic Location (Zv9):
Chromosome 24 (position 25837725)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25084603
GRCz11 24 25229777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACTGAAGTCTGACAGCCAGCAGCTCCTGCAGCATAATGGCCGTTTG[C/T]AGGCAGTCGCTGACCAGCATCAGGAGCTCAAGGGCACCTATAACCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081043 Nonsense 815 896 20 21
Genomic Location (Zv9):
Chromosome 24 (position 25841155)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25088033
GRCz11 24 25233207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAAGTGTGCTGCTGTACTAAACAGGTCTTCAGAATGAGCTGAGGAGA[C/T]AAGAAGAGCAGATCAAGGAGATGGAGGAGAATATTTCCATCCTCAGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link