slc39a1

Ensembl ID:
ENSDARG00000058257
ZFIN ID:
ZDB-GENE-030131-9917
Description:
Zinc transporter ZIP1 [Source:UniProtKB/Swiss-Prot;Acc:P59889]
Human Orthologue:
SLC39A2
Human Description:
solute carrier family 39 (zinc transporter), member 2 [Source:HGNC Symbol;Acc:17127]
Mouse Orthologue:
Slc39a2
Mouse Description:
solute carrier family 39 (zinc transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:2684326]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34016 Nonsense Mutation detected in F1 DNA During 2018
sa9435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062257 Nonsense 79 302 2 4
Genomic Location (Zv9):
Chromosome 7 (position 14777710)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13658723
GRCz11 7 13903360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACATCATCCCAGACTACCTGTCTGACATACACGGAGAACTTCAAAAA[C/T]GAGACCTTGATGTGAGTTCAAGGAAACATGCTTTTCCATATTTAAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062257 Nonsense 155 302 3 4
Genomic Location (Zv9):
Chromosome 7 (position 14775141)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13656154
GRCz11 7 13900791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTGGAGGGGAGTGGACATCACGTTCATGTGGATTTTCATGCGCACT[C/A]ATCCTTCCGCTCYTTCATGCTCTTCCTGTCTCTCTCTCTTCACTCCGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link