zgc:113312

Ensembl ID:
ENSDARG00000058256
ZFIN ID:
ZDB-GENE-050913-20
Description:
Draxin [Source:UniProtKB/Swiss-Prot;Acc:Q4V9H3]
Human Orthologue:
C1orf187
Human Description:
chromosome 1 open reading frame 187 [Source:HGNC Symbol;Acc:25054]
Mouse Orthologue:
2610109H07Rik
Mouse Description:
RIKEN cDNA 2610109H07 gene Gene [Source:MGI Symbol;Acc:MGI:1917683]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41800 Nonsense Mutation detected in F1 DNA During 2018
sa11182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081098 Nonsense 133 360 2 7
Genomic Location (Zv9):
Chromosome 11 (position 16357599)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15838299
GRCz11 11 15972934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTCAAGGAAGTCATCCAGCAGAAGGAGAGTTAAATCGTAAAGGCAGA[C/T]GACATAGTCACAGGCTTCTGGCTGAGCACAGAAAGCATGGAGGCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081098 Nonsense 153 360 2 7
Genomic Location (Zv9):
Chromosome 11 (position 16357659)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15838359
GRCz11 11 15972994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYAGGCTTCTGGCTGAGCACAGAAAGCATGGAGGCAAAAAAGACAAAGGT[C/T]GAGGTAAAGGTAATAGAGATTTTCTTGATCACACTAACTTATTTAGTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link