adamts15

Ensembl ID:
ENSDARG00000058252
Human Orthologue:
ADAMTS8
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 8 [Source:HGNC Symbol;Acc:224]
Mouse Orthologue:
Adamts8
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 Gene [

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42518 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062378 Nonsense 750 927 9 9
Genomic Location (Zv9):
Chromosome 15 (position 16670360)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17715323
GRCz11 15 17651345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCCACTGTGGAGCAGCATATTCCAGTGCTGGGCGCTGTGCTGAAGTA[C/A]AGTGGCTCTTCAACAACACTTGAGAGACTTCAGAGCTTCCGGCAACTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link