zgc:172129

Ensembl ID:
ENSDARG00000058243
ZFIN ID:
ZDB-GENE-080220-4
Description:
hypothetical protein LOC556928 [Source:RefSeq peptide;Acc:NP_001107883]
Human Orthologue:
PHACTR3
Human Description:
phosphatase and actin regulator 3 [Source:HGNC Symbol;Acc:15833]
Mouse Orthologue:
Phactr3
Mouse Description:
phosphatase and actin regulator 3 Gene [Source:MGI Symbol;Acc:MGI:1921439]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3239 Essential Splice Site F2 line generated During 2018
sa43924 Nonsense Mutation detected in F1 DNA During 2018
sa37637 Essential Splice Site Available for shipment Available now
sa12783 Nonsense Available for shipment Available now
sa37636 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa3239
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Essential Splice Site 90 498 2 12
ENSDART00000133956 Essential Splice Site 117 525 2 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12384727)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12343529
GRCz11 23 12278499
KASP Assay ID:
554-3383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAATGGAGGAAAAAGAAAAACGAGAAGCTGAAACAGAGCTCTACAGG[T/A]AAGAAAATATGGTTGTTTTATAATTTGTTTAGTGCATTGAACTGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Nonsense 147 498 4 12
ENSDART00000133956 Nonsense 174 525 4 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12369344)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12328146
GRCz11 23 12263116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTTCCTCACCTGCAATTTTGTGTTTCCTTTAGTGGTAGATTCCTTA[C/T]AGGACACAGAGCCGACAGAAGACCCAAAATCAAATGAAGAAGAGGGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Essential Splice Site 213 498 4 12
ENSDART00000133956 Essential Splice Site 240 525 4 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12369144)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12327946
GRCz11 23 12262916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAAACAGCCATGGCAATCTGGTCTCTCAGCTCAGCACTGAGGAAGG[T/A]CTGTTCATCTCTGCGTAATCAAAAATAGGCACGGCTTACTTTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Nonsense 319 498 6 12
ENSDART00000133956 Nonsense 346 525 6 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12366730)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12325532
GRCz11 23 12260502
KASP Assay ID:
2261-7413.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAACGTTCGACAGGATCACTGCTTCACTGATGCTTCAGGAATTATCTA[T/A]GATATCGWCAGCTGGAACGACTCTGTCATTTCTGGTGRGTGTAACTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Essential Splice Site 401 498 None 12
ENSDART00000133956 Essential Splice Site 428 525 None 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12347011)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12305813
GRCz11 23 12240783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGAGTGACCCGTTTGATTCAATCACTCAGACTTTCTTTGCTCTTTC[A/T]GAGAGGAACGATCAGACGGAACAGGAGGAAAGAAGAGAGATCAAACAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link