ssbp3

Ensembl ID:
ENSDARG00000058237
ZFIN IDs:
ZDB-GENE-070705-484, ZDB-GENE-070705-484
Description:
single stranded DNA binding protein 3 [Source:RefSeq peptide;Acc:NP_001124115]
Human Orthologues:
AP002414.1, SSBP2, SSBP4
Human Descriptions:
single stranded DNA binding protein 4 [Source:HGNC Symbol;Acc:15676]
single-stranded DNA binding protein 2 [Source:HGNC Symbol;Acc:15831]
Mouse Orthologues:
Ssbp2, Ssbp4
Mouse Descriptions:
single stranded DNA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1924150]
single-stranded DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914220]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39781 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17149 Nonsense Available for shipment Available now
sa39780 Nonsense Mutation detected in F1 DNA During 2018
sa31260 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081072 Essential Splice Site 148 389 7 18
ENSDART00000097741 Essential Splice Site 123 364 6 17
Genomic Location (Zv9):
Chromosome 2 (position 10740104)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11165200
GRCz11 2 10948799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGTGGATGTTGCATTGTGTTTTTTTAAGTCACTGTGTTTCCATTTGC[A/C]GCCATTTATGTCACCTCGCTATGCTGGAGGACCTCGACCGCCCATGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081072 Nonsense 266 389 12 18
ENSDART00000097741 Nonsense 241 364 11 17
Genomic Location (Zv9):
Chromosome 2 (position 10734214)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11159310
GRCz11 2 10942909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTTTGGCTTCAYAGATCTCATATTCCTCTTCATCCCCWGGAAYATA[T/A]GTGGTAAGGGGCTGTTTTTTTTNNNNNNNNNNNNNNGTATTTGGTTTAGTAATAWCGCCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081072 Nonsense 278 389 13 18
ENSDART00000097741 Nonsense 253 364 12 17
Genomic Location (Zv9):
Chromosome 2 (position 10734087)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11159183
GRCz11 2 10942782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTGTGTTTTCTCAGGGTCCTCCAGGAGGAGCAGGAGGTGGTGGATG[T/A]CCTCCAGGAACACCTATCATGCCAAGTCCAGCAGGTAAAGGCTGATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081072 Nonsense 311 389 14 18
ENSDART00000097741 Nonsense 286 364 13 17
Genomic Location (Zv9):
Chromosome 2 (position 10730368)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11155464
GRCz11 2 10939063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTGAAAACCTCTACACATTGATAAACTCAGTGCCACCAGGAGGAAAC[A/T]GATCCAGTGTGAGTTCCTCCGTTCCTCTAGCCTTTATTAAACATTAGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link